2. Materials and Methods
2.1. Introduction
The practical components of this work consisted of five major sections: (i) cloning of genes encoding the extra-cellular domains of the ftsL, divIC and divIB genes from B. subtilis and G. stearothermophilus and their subsequent over-expression and purification; (ii) spectroscopic and multi angle laser light scattering (MALLS) analysis of these isolated proteins and potential hetero- and homo-interactions; (iii) proteolytic analysis of B. subtilis and G. stearothermophilus DivIB protein and subsequent subcloning of protease resistant domains; (iv) determination of the 3-dimensional NMR structure of domain within G. stearothermophilus DivIB generated by the proteolytic analysis mentioned above and (v) in vivo examination of various divIB mutations by complementation of a B. subtilis divIB null strain.
2.2 Cloning, overexpression and purification of divIB, ftsL and divIC
2.2.1 Construction of overexpression strains
The extracytoplasmic domains of DivIB, FtsL and DivIC from B. subtilis (strain JH462) and G. stearothermophilus (strain xxxx) were cloned from the corresponding chromosomal DNA by PCR amplification using primers described in Table 2.1. This cloning strategy allowed for insertion of amplified genes into the pGEXT-2T vector (Amersham Pharmacia Biotech - APB, Piscataway, NJ) using BamHI and EcoRI cloning sites. The resultant vector results in a fusion of the inserted gene to the C-terminus of the Schistosoma japonicum glutathione S-transferase (GST) gene with an intervening thrombin recognition site. The resulting plasmids (listed in Table 2.1) were transformed into the E. coli strain DH5 [supE33 lacU169 (80 lacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1] for stable storage and BL21 [ompT gal [dcm] [lon] hsdSB (rB-, mB-) DE3 prophage] for expression.
The extracytoplasmic domains where overproduced as GST-fusions by growing the respective BL21 strain in either LB media or a minimal media designed for incorporation of 15N and/or 13C nuclei (see Section 2.2.1 for description of media). After reaching an A600 of 0.6–0.8, cultures were induced to express the fusion protein by addition of 100 µM isopropyl-1-thio--D-galactopyranoside (IPTG). The cells were harvested by centrifugation after 3 hours and frozen at -80 º C for no longer than 1 week before further processing. Cell pellets were defrosted and resuspended in lysis buffer (50 mM NaCl, 50 mM Tris, 1 mM EDTA, pH 8.0). Cells were then lysed by three passes through a French pressure cell at 10 000 psi. The recombinant fusion proteins was purified from the soluble cell fraction using affinity chromatography on GSH–Sepharose columns (APB). After purification on the column, the column beads were equilibrated with thrombin cleavage buffer (TCB, 150 mM NaCl, 20 mM Tris, 1 mM CaCl2, pH 8.0) and incubated with 100 U of thrombin (Sigma, St. Louis, MO) for no more than 1.5 hours with frequent stirring. Longer incubation times were particularly avoided for the FtsL and DivIC constructs as they readily degrade during this process. Recombinant extracytoplasmic
Table 2.1: List of primers used for cloning of each extracytoplasmic construct and the associated plasmid name.
| Oligo. Name:Oligo. Name:Oligo. Name: | Nucleotide Sequence (5’- 3’)Nucleotide Sequence (5’- 3’)Nucleotide Sequence (5’- 3’) | Plasmid NamePlasmid NamePlasmid Name | Construct NameConstruct NameConstruct Name |
|---|---|---|---|
| Bsub-FtsL-FBsub-FtsL-FBsub-FtsL-F | CGTGGATCCAAGGCGTATGCGGCATATCCGTGGATCCAAGGCGTATGCGGCATATCCGTGGATCCAAGGCGTATGCGGCATATC | pSAR11pSAR11pSAR11 | Bsub-FtsL54-117BsubBsub-FtsL-FtsL54-11754-117 |
| Bsub-FtsL-RBsub-FtsL-RBsub-FtsL-R | GGATTCTCATTCCTGTATGTTTTTCACGGATTCTCATTCCTGTATGTTTTTCACGGATTCTCATTCCTGTATGTTTTTCAC | ||
| Bsub -DivIC-FBsub -DivIC-FBsub -DivIC-F | CGTGGATCCCAAACATCTTCCCTTAGTGCCGTGGATCCCAAACATCTTCCCTTAGTGCCGTGGATCCCAAACATCTTCCCTTAGTGC | pSAR12pSAR12pSAR12 | Bsub-DivIC58-125BsubBsub-DivIC-DivIC58-12558-125 |
| Bsub -DivIC-RBsub -DivIC-RBsub -DivIC-R | GGAATTCCTACTTGCTCTTCTTCTCCGGAATTCCTACTTGCTCTTCTTCTCCGGAATTCCTACTTGCTCTTCTTCTCC | ||
| Bsub -DivIB-FBsub -DivIB-FBsub -DivIB-F | CGTGGATCCAGTAAAGTATCAACAATCCGTGGATCCAGTAAAGTATCAACAATCCGTGGATCCAGTAAAGTATCAACAATC | pSAR20pSAR20pSAR20 | Bsub-DivIB54-263BsubBsub-DivIB-DivIB54-26354-263 |
| Bsub -DivIB-RBsub -DivIB-RBsub -DivIB-R | GGAATTCTCAATTTTCATCTTCCTTTTTAGCGGAATTCTCAATTTTCATCTTCCTTTTTAGCGGAATTCTCAATTTTCATCTTCCTTTTTAGC | ||
| Bste-FtsL-FBste-FtsL-FBste-FtsL-F | CGTGGATCCAACCAAGTGCGCATTTACGCGTGGATCCAACCAAGTGCGCATTTACGCGTGGATCCAACCAAGTGCGCATTTACG | pSAR13pSAR13pSAR13 | Bste-FtsL63-126BsteBste-FtsL-FtsL63-12663-126 |
| Bste -FtsL-RBste -FtsL-RBste -FtsL-R | GGAATTCTCATTCCTGCACAAACTTTCACATGGGGAATTCTCATTCCTGCACAAACTTTCACATGGGGAATTCTCATTCCTGCACAAACTTTCACATGG | ||
| Bste -DivIC-FBste -DivIC-FBste -DivIC-F | CGTGGATCCCAAGCGAAGGCGATCGATGCCGTGGATCCCAAGCGAAGGCGATCGATGCCGTGGATCCCAAGCGAAGGCGATCGATGC | pSAR14pSAR14pSAR14 | Bste-DivIC58-123BsteBste-DivIC-DivIC58-12358-123 |
| Bste -DivIC-RBste -DivIC-RBste -DivIC-R | GGAATTCTTATTTTTCCGGCAAGACGGGAATTCTTATTTTTCCGGCAAGACGGGAATTCTTATTTTTCCGGCAAGACG | ||
| Bste -DivIB-FBste -DivIB-FBste -DivIB-F | CGTGGATCCCCGCTTGGCGCTGTCGGGCATGCGTGGATCCCCGCTTGGCGCTGTCGGGCATGCGTGGATCCCCGCTTGGCGCTGTCGGGCATG | pSAR15pSAR15pSAR15 | Bste-DivIB46-261BsteBste-DivIB-DivIB46-26146-261 |
| Bste -DivIB-RBste -DivIB-RBste -DivIB-R | GGAATTCCTACGGGCTTGTCGTTTCATCCCCATCCTCGGAATTCCTACGGGCTTGTCGTTTCATCCCCATCCTCGGAATTCCTACGGGCTTGTCGTTTCATCCCCATCCTC |
domains released by thrombin cleavage where either purified by extra chromatographic techniques immediately or stored at 4º C for no longer than 1 night with the addition of 500 M phenylmethylsulfonyl fluoride (PMSF) and 1mM ethylenediaminetetra-acetic acid (EDTA).
2.2.2. Preparation of growth media and competent Esherichia coli strains
Casein peptone pancreatic digest type M (CPPD), yeast extract and agar (Bacto-Agar) was supplied by Difco Laboratories (Detroit, MI, USA). Luria-Bertani (LB) medium was composed of 10 g CPPD, 5 g yeast extract and 5 g NaCl per liter of water and was sterilized by autoclaving ay 121º C and 18 psi for 25 minutes. SOB medium was composed by adding 20 g CPPD, 5 g yeast extract and 0.5 g NaCl to 950 ml of water. 10 ml of 250 mM KCl was then added and the pH of the medium adjusted to 7.0 with 10 M NaOH. Finally the volume of solution was adjusted to one liter and autoclaved as above. Minimal media was prepared as described previously {Weber, 1992 #173}. 15NH4Cl and [U-13C]-D-glucose were used in the above media to incorporate 15N and 13C isotopes into expressed proteins.
LB-agar plates were made by the addition of 1.5 g Bacto-Agar to 100 ml of LB media and autoclaved as above. Media was cooled to below 50 ˚C were upon antibiotics were added to a final concentration of 100 gml-1. The media was then poured into sterile petri dishes under aseptic conditions and allowed to set at room temperature before being dried at 37 ˚C for 1 hour.
2.2.3. Chromatographic purification of recombinant proteins
Because the extracytoplasmic domains of DivIB, FtsL and DivIC were all subject to degradation during the above processing, two further chromatographic procedures were used to achieve >95% homogeneity (as judged by SDS-PAGE). In each case, ion-exchange chromatography was used first. Table 2.2 outlines the basic FPLC protocol used to bind and elute recombinant proteins by addition of a salt gradient.
Table 2.2: Salt-gradient profile for ion-exchange chromatography. Table 2.3 outlines the constituents of buffers A and B.
| TimeTimeTime | % buffer A% buffer A% buffer A | % buffer B% buffer B% buffer B | Flow Rate (ml•min-1)Flow Rate (ml•minFlow Rate (ml•min-1-1)) |
|---|---|---|---|
| 000 | 100100100 | 000 | 1.01.01.0 |
| 333 | 100100100 | 000 | 1.01.01.0 |
| 161616 | 828282 | 181818 | 1.01.01.0 |
| 171717 | 000 | 100100100 | 1.01.01.0 |
| 181818 | 000 | 100100100 | 1.01.01.0 |
| 191919 | 100100100 | 000 | 1.01.01.0 |
| 242424 | 100100100 | 000 | 1.01.01.0 |
Because the recombinant domains varied greatly in their pI, Mono-S (anion exchange) and Mono-Q (cation-exchange) columns were both used. Table 2.3 outlines the conditions used for each construct. In each case, recombinant proteins eluted between the 12- and 16-minute time points during chromatography.
Table 2.3: List of the extracytoplasmic constructs with matching ion exchange columns and buffer conditions used during purification Buffer conditions refer to “Buffer A” in Table 2.2. In all cases, buffer B constituted buffer A plus 2 M NaCl.
| ConstructConstructConstruct | Column UsedColumn UsedColumn Used | Buffer ConditionsBuffer ConditionsBuffer Conditions |
|---|---|---|
| Bsub-FtsL54-117BsubBsub-FtsL-FtsL54-11754-117 | Mono-SMono-SMono-S | 10 mM Phosphate, pH 6.710 mM Phosphate, pH 6.710 mM Phosphate, pH 6.7 |
| Bsub-DivIC58-125BsubBsub-DivIC-DivIC58-12558-125 | Mono-QMono-QMono-Q | 10 mM Tris, pH 8.910 mM Tris, pH 8.910 mM Tris, pH 8.9 |
| Bsub-DivIB54-263BsubBsub-DivIB-DivIB54-26354-263 | Mono-QMono-QMono-Q | 10 mM Tris, pH 8.010 mM Tris, pH 8.010 mM Tris, pH 8.0 |
| Bste-FtsL63-126BsteBste-FtsL-FtsL63-12663-126 | Mono-QMono-QMono-Q | 10 mM Tris, pH 8.910 mM Tris, pH 8.910 mM Tris, pH 8.9 |
| Bste-DivIC58-123BsteBste-DivIC-DivIC58-12358-123 | Mono-SMono-SMono-S | 10 mM Phosphate, pH 6.710 mM Phosphate, pH 6.710 mM Phosphate, pH 6.7 |
| Bste-DivIB46-261BsteBste-DivIB-DivIB46-26146-261 | Mono-QMono-QMono-Q | 10 mM Tris, pH 8.010 mM Tris, pH 8.010 mM Tris, pH 8.0 |
Ion exchange chromatography was followed by gel filtration chromatography on a Superdex 75 column (APB). The running buffer used during gel filtration chromatography depended on the experimental conditions the construct was destined. See individual experimental method sections for details.
2.3. Biophysical analysis of extracytoplasmic domains
2.3.1 Protein Concentration determination
Protein concentration was determined using absorbance at 280 nm of a 100-fold dilution of protein in 6 M guadinium hydrochloride, 20 mM sodium phosphate buffer pH 6.5 and applying the following equation based on the Beer-Lambert law:
A = cl (2.1)
Where A is the absorbance at 280 nm, is the monomeric molar extinction coefficient calculated using the PlotParam program from the EXPASY web site (http://www.expasy.ch/tools/protparam.html), c is the molar concentration, and l is the light path in cm. Molar extinction coefficients are listed in table 2.4
Table 2.4: List of extracytoplasmic domains with matching molar extinction coefficients at 280 nm.
| Protein NameProtein NameProtein Name | Extinction coefficient for 280 nm (M-1 cm-1)Extinction coefficient for 280 nm (MExtinction coefficient for 280 nm (M-1-1 cm cm-1-1)) |
|---|---|
| Bsub-FtsL54-117BsubBsub-FtsL-FtsL54-11754-117 | 256025602560 |
| Bsub-DivIC58-125BsubBsub-DivIC-DivIC58-12558-125 | 128012801280 |
| Bsub-DivIB54-263BsubBsub-DivIB-DivIB54-26354-263 | 241802418024180 |
| Bste-FtsL63-126BsteBste-FtsL-FtsL63-12663-126 | 384038403840 |
| Bste-DivIC58-123BsteBste-DivIC-DivIC58-12358-123 | 384038403840 |
| Bste-DivIB46-261BsteBste-DivIB-DivIB46-26146-261 | 285902859028590 |
2.3.3. MALLS analysis of extracytoplasmic domains and interactions
Analysis of the extracytoplasmic domains using multiangle laser light scattering (MALLS) was performed by first subjecting individual and mixed proteins to gel filtration on a Superdex 75 column. Eluted proteins were then passed through a miniDAWN light scattering detector and OptiLab refractometer (Wyatt Technology, Santa Barbara). Weight-average molecular weights were determined using the Debye fitting method (ASTRA software package; Wyatt Technology, Santa Barbara) as described previously (Folta-Stogniew and Williams 1999).
2.3.4. Circular Dichroic analysis of extracytoplasmic domain secondary structure
Far UV circular dichroism (CD) spectroscopy was used to determine the intrinsic secondary structure each extracytoplasmic domain had in isolation. CD thermal melt curves where also generated to assess the thermal stability of the secondary structures present. Pure protein samples where prepared as outlined in Section 2.2.3. Gel filtration was performed using a running buffer of 1 mM NaH2PO4 pH 6.8, 50 mM NaCl. Purified proteins were then concentrated in a Centriplus YM-3 Centrifugal Filter provided by Millipore (Bedford, MA, USA) to a volume of 3-5 ml. Protein solutions (3 ml) were then subsequently dialysed against 3 changes of 500 ml CD buffer (1 mM NaH2PO4 pH 6.8, 50 mM NaF) inside a Slide-A-Lyzer® dialysis cassette, 3500 Da molecular weight cut-off (Pierce, Rockford, IL, USA). Spectra were acquired using a Jasco J-710 spectropolarimeter. Final spectra were the average of eight transients collected in a 0.1 cm rectangular quartz cell collected in the wavelength range 250 nm to 190 nm, using a scan rate of 20 nm min-1 and a bandwidth of 1 nm. A spectrum of dialysis buffer was taken with the exact same parameters and subtracted from the spectrum for each protein sample, giving a baseline corrected spectrum. Thermal melt curves were generated by monitoring the ellipticity at 222 nm as a function of temperature. Data was recorded every 1º C as the temperature was increased from 4º C to 90º C at a rate of 1º C min-1.
Raw ellipticity values were converted to mean residue weighted (MRW) ellipticity (also symbolized as []MRW) using the following equation:
.100.MRW
[]MRW = c.d (2.2)
where is the baseline corrected ellipticity in degrees, 100 originates from the conversion of molar concentration to dmol cm-3, MRW is the mean residue weight (molecular weight divided by the number of residues), c is the concentration in mg ml-1 and d is the optical path length in cm. Proteins were analyzed at a concentration of 10 M for spectral analysis while thermal melts were performed on proteins at 50 M.
2.3.5. CD analysis of extracytoplasmic domain interactions
Extracytoplasmic domains of FtsL and DivIC from B. subtilis and G. stearothermophilus were assayed for hetero-interactions by mixing the individual proteins as prepared in section 2.2 (buffered as outlines in Section 2.3.4) and recording spectra between 250 nm and 190 nm as described above. The final concentration of each protein was adjusted to 10 M. In calculating the []MRW for a mixed sample, MRW was calculated as the combined molecular weight of the two proteins divided by the total number of residues in both proteins.
2.3.6 Ion-exchange chromatographic analysis of interactions
Cation exchange chromatography was performed using a Mono-S (anion exchange) column. Buffer conditions were as outlined above for the purification of Bsub-FtsL54-117 by ion exchange chromatography using buffer A. Under these conditions, Bsub-FtsL54–117 elutes at ~15% buffer B (300 mM NaCl), whereas Bsub-DivIC58–125 elutes in the void. Both void and retained peaks were collected, lyophilized and analysed using SDS–PAGE. Proteins were injected individually at a concentration of 50 M or as an equimolar mixture (each 50 M). Mixtures of proteins were allowed to equilibrate after mixing for 30 minutes on ice (~4º C).
2.3.7 NMR analysis of extracytoplasmic domains and interactions
NMR experiments for analysis of protein-protein interactions were performed at 25º C on a Varian INOVA 600 MHz spectrometer using uniformly 15N-labelled proteins purified as described in Section 2.2. The labelled proteins were concentrated to 500 M in NMR buffer (20 mM sodium phosphate, 100mM NaCl, pH 6.8) using 3 000 Da cut-off centrifugal concentrators. The pH was checked and adjusted to 6.8 where necessary; then the samples were clarified using 0.45 mm microfuge filters. Samples of individual proteins were obtained by adding 125 l of protein solution,125 l of NMR buffer and 20 ml of 99.96% D2O to a susceptibility-matched microcell (Shigemi) to give a final protein concentration of a 230 M. Equimolar mixtures (230 M of each protein) were prepared by adding 125 l of each extracytoplasmic domain (250 l total volume) to 20 l of 99.96% D2O in a susceptibility-matched microcell (Shigemi). 15N-edited, sensitivity-enhanced two-dimensional HSQC spectra were acquired and NMR data were processed with nmrPIPE (Delaglio, Grzesiek et al. 1995) using a script generator available at http://sbtools.uchc.edu/nmr/. The comparison of spectra from individual and mixed protein experiments was performed visually by overlaying spectra in Adobe Photoshop.
2.3.8 Spectroscopic analysis of interactions with SUVs
Small unilaminar vesicles (SUVs) were prepared by mixing L--phophatidyl-DL-glycerol (PG) and L--phophatidyl-DL-ethanolamine (PE) (10 mgml-1; Avanti Polar Lipids, QTH) in a ratio of 1:3. 200 l of this stock mix was taken and dried in a test tube under argon for about 30 minutes. This ratio of PE to PG (refered to as PEG here after) resembles the lipid content of B. subtilis membranes. The remaining powder was then further dried under centrifuge vacuum for 1 hour. Phospholipids were then hydrated with 200 l “CD buffer” (1 mM Phosphate, pH 7.40, 50 mM NaF). The suspension was votexed for 1 minute followed by 30 minutes of sonication in a waterbath. After 30 minutes of sonication the solution was checked for clarity (an indication of SUV formation). Prepared SUVs (PEG) were used on the same day as their preparation in all cases.
2.4. Proteolysis of B. subtilis and G. stearothermophilus DivIB
2.4.1 Proteolytic digestion of extracytoplasmic DivIB domains
Bsub-DivIB54-263 and Gste-DivIB46-261 were purified as described in section 2.2. Final gel filtration buffer was composed of 10 mM Tris pH 8.0 and 150 mM NaCl (proteolysis buffer). Protein concentration was adjusted to 250 g ml-1. Digestions were conducted with a 1:100 or 1:200 (w/w) ratio of protease to DivIB protein. Typically 1.25 g of trypsin (Sigma) or V8 (Sigma) protease from a 1 mg ml-1 stock (prepared in 1 mM HCL) was mixed into 500 l of protein solution. Protein solutions were allowed to equilibrate to the relevant reaction temperature for 15 minutes before the addition of protease. Samples of the digestion (20 l) were taken at hourly time points and boiled in 20 l of 2x glycine gel loading buffer immediately. Four samples were taken, including a zero time point before addition of protease, to monitor the development of resistant domains over a period of 3 hours. After the reaction, the remaining digestion reaction was stopped by addition of 2 l of 100 mM PMSF in isopropanol and frozen at -80 ˚C. Preparation of larger quantities of specific fragments of Gste- DivIB46-261 (preparative proteolysis) was conducted in a smiliar fashion without the collection of time points.
2.4.3. rpHPLC analysis and determination of proteolyzed fragments
After preparative proteolysis, 200 l of the reaction mixture was electrophoresed on an SDS-PAGE gel before being blotted onto a PVDF membrane. Bands corresponding to fragments 1 and 2 (see Figure 4.1B) were excised and submitted for N-terminal sequencing by Edman degradation. The remaining 300 l of each reaction mixture was lyophilized, resuspended in 200 l water containing 0.1% TFA (~pH 3) to deactivate trypsin, then proteolytic fragments were purified for electrospray mass spectrometry using reverse-phase HPLC. The combination of N-terminal sequencing and accurate molecular mass allowed for precise determination of the primary structure of the fragments (see Figure 4.2A).
2.4.4 Subcloning and screening of the trypsin resistant Gste-DivIB fragments for NMR
The two fragments of Gste-DivIB determined above were subcloned from plasmid pSAR15 using the same protocol described in Section 2.2.1. Briefly, fragment 1 (Gste-DivIB) was PCR amplified and ligated into pGEX-2T using primers 5’-CGTGGATCCCCGCTTGGCGCTGTCGGGCATG-3’ and 5’-GGAATTCCTATTTGACGTTTCGGTCAAGCG -3’ while fragment 2 (Gste-DivIB) was PCR amplified and ligated into pGEXT-2T using primers 5’-CGTGGATCCGAATGGCGGCGAATCGCTTATG-3’ and 5’-GGAATTCCTATTTGACGTTTCGGTCAAGCG-3’. Gste-DivIBand Gste-DivIBwere purified as described above for Gste-DivIB. 15N-edited, sensitivity-enhanced two-dimensional HSQC spectra were acquired for Gste-DivIBin an NMR buffer composed of 20 mM Na3PO4 and 700 mM NaCl pH 6.7. An HSQC spectrum was acquired for Gste-DivIBin an NMR buffer composed of 20 mM Na3PO4 and 150 mM NaCl pH 6.0.
2.5. Solution structure determination of Gste-DivIB
2.5.1. Over-expression and purification of 15N and 13C labeled Gste-DivIB
Gste-DivIBwas uniformly labeled with 13C and 15N by growing the E. coli overexpression strain in a minimal media as described above in Section 2.2. To prevent protein breakdown, AEBSF (10 M), EDTA (10 M) and NaN3 (1 mM) were added. Gste-DivIBwas concentrated to ~ 1 mM550 l of protein sample was placed inside a standard NMR tube (source) to which an additional 50 l of D2O was added. This final solution constituted the protein sample used for all further NMR experiments conducted in H2O. For NMR experiments performed in D2O, Gste-DivIB was exchanged into D2O buffer by first taking a 25 ml volume of NMR buffer and freeze drying it. 25 ml of D2O was added to reconstitute the buffer to original volume, pH and chemical concentrations. Gste-DivIB was concentrated until approximately 500 l remained. This protein solution was then re-diluted with D2O buffer to 5 ml and the procedure repeated until 4 exchanges of D2O buffer had taken place (theoretically H2O should be reduced to 0.1% of total solvent).
2.5.2. Acquisition of NMR data and structure determination
NMR experiments were performed on a four-channel Varian INOVA 600 or 500 MHz NMR spectrometer. All experiments were performed at 35 ºC. 3D HNCACB, CBCA(CO)NH, HN(CA)CO and HNCO data was used for backbone assignments. Side chain atoms were assigned from HNHB, C(CO)NH-TOCSY, HC(CO)NH-TOCSY and HCCH-TOCSY (in D2O buffer) data. Interproton distance restraints were obtained from 15N-edited NOESY and 13C-edited NOESY (in D2O buffer). Dihedral-angle restraints were obtained from TALOS analysis of H, C, C, C, and N chemical shifts (Cornilescu, Delaglio et al. 1999); the ranges were set to twice the standard deviation of the TALOS prediction. Data was processed using NMRPipe (Delaglio, Grzesiek et al. 1995) using an in-house web-based script generator (http://bambam.uchc.edu/~nmr/sbtools/). Processed spectra were analyzed and peaks were integrated in the program XEASY (Bartles, Xia et al. 1995). Automatic NOE assignments were made using the CANDID macro in CYANA (Herrmann, Guntert et al. 2002) followed by manual refinement.
2.6. Complementation studies with mutant divIB genes
2.6.1 Construction of B. subtilis strains
Complementation studies of B. subtilis strain SU321 (divIB::cat), kindly provided by Dr. Liz Harry, were conducted by incorporating ectopic copies of divIB and mutant divIB genes at the amyE locus using the vector pDG364. Because pDG364 carries chloramphenicol resistance as a marker for amyE incorporation and SU321 is already chloramphenicol resistant, SU321 chloramphenicol resistance was converted to erythromycin using pCm::Er (Steinmetz and Richter 1994). This resulted in strain RSA8 (divIB::cat::ermC). RSA8 was verified as being resistant to erythromycin, but not chloramphenicol, and displays the temperature-sensitive phenotype of SU321. The wild-type B. subtilis divIB gene, including its native promoter, was PCR amplified from B. subtilis strain JH642 using primers 5’-CCCAAGCTTTTCAAGTTCTGACTGAAGC-3’ (Bsub-F) and 5’-GCTAAAAAGGAAGATGAAAATTGAGAATTCCG-3’ (Bsub-R) and cloned into the HindIII and EcoRI sites of pDG364 to create pSAR50.
Single alanine point mutations were introduced into the divIB gene using PCR with pSAR50 as the template. Mutagenic primers incorporating the desired mutation were used with either Bsub-F or Bsub-R for the cloning of 5’ or 3’ ends of the divIB gene using pSAR50 as a template. PCR fragments where then reconstructed by using the 5’ and 3’ ends of the divIB gene generated in a new PCR reaction with the primers Bsub-F and Bsub-R. Each mutant PCR product was purified, digested, and subcloned as for pSAR50.
Ectopic copies of B. subtilis divIB were integrated into RSA8 by double crossover at the amyE locus using pSAR50 or its derivatives, which also integrates a chloramphenicol resistance cassette. Strains RSA9 (divIB::cat::ermC amyE::divIB-cat) through RSA31 were all constructed by transforming RSA8 with plasmids listed in Table 5.1 Transformants were checked for double-crossover interruption of amyE by their inability to digest soluble starch (Cutting 1990).
2.6.2 Plate assay of complementation
Temperature sensitivity of resultant strains was tested by streaking strains on triplicate plates grown at 30° C, 42º C and 48° C or duplicate plates grown at 30º C or 48º C for 24 hours.